ktrC [2018-02-10T14:56:17.000Z]

low affinity potassium transporter KtrC-KtrD, peripheric membrane component

Locus: BSU14510

Isoelectric point: 5.63

Molecular weight: 24.20 kDa

Protein length: 221 aa

Gene length: 663 bp

Function: potassium uptake

Product: low affinity potassium transporter KtrC-KtrD, peripheric membrane component (proton symport)

Essential: no

Synonyms: ylxV,yzaC,ykqB

Genomic Context

Loading

Categories containing this gene/protein

• Cellular processes → Transporters → Transporters/ other → Metal ion transporter
• Cellular processes → Homeostasis → Metal ion homeostasis (K, Na, Ca, Mg) → Potassium uptake/ export
• Information processing → Targets of second messengers → Targets of c-di-AMP
• Lifestyles → Coping with stress → Coping with hyper-osmotic stress
• Groups of genes → Membrane proteins

Gene

Coordinates: 1,520,531 → 1,521,196

The protein

Paralogous protein(s)

• KtrA

Domains

• contains a RCK_N domain at the N-terminus (according to UniProt)
• contains a c-di-AMP-binding RCK_C domain at the C-terminus (according to UniProt) PubMed

Effectors of protein activity

• the protein binds c-di-AMP PubMed

Structure

• 4J7C (the KtrA-KtrB complex, 56% identity) PubMed
• 4XTT (the S. aureus KtrA RCK_C domain in complex with c-di-AMP, 57% identity) PubMed

Localization

• peripheral membrane protein PubMed

Expression and Regulation

Operons

• Genes: ktrC
  Description: PubMed

  Regulation

  • constitutively expressed PubMed

• Genes: kinC-ykqA-ktrC
  Description: PubMed

  Sigma factors

  • SigA: sigma factor, PubMed, in SigA regulon

  Regulatory mechanism

  • Spo0A: activation, PubMed, in Spo0A regulon

  Regulation

  • constitutively expressed PubMed

Biological materials

Mutant

• MGNA-A904 (ykqB::erm), available at the NBRP B. subtilis, Japan
• GHB6 (ktrC::spec), PubMed (available in Erhard Bremer's and Jörg Stülke's) labs, available at BGSC as 1A955
• GP2264 (ΔktrC::aphA3), available in Jörg Stülke's lab PubMed
• GP2048 (ΔktrC::cat), available in Jörg Stülke's lab PubMed
• GP2079 (ΔktrC::tet), available in Jörg Stülke's lab PubMed
• GP2083 (ΔktrA-ktrB::aphA3 ΔktrC::tet), available in Jörg Stülke's lab PubMed
• BKE14510 (ΔktrC::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATCGTGGTGCTCCTTTATA, downstream forward: _UP4_TAGCAGCCAAATAAGCCGTC
• BKK14510 (ΔktrC::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATCGTGGTGCTCCTTTATA, downstream forward: _UP4_TAGCAGCCAAATAAGCCGTC

Expression vector

• pGP2907 (N-terminal His-tag, purification from E. coli, in pWH844), available in Jörg Stülke's lab

Labs working on this gene/protein

• Erhard Bremer, University of Marburg, Germany homepage

References

Reviews

Loading

Original publications

Loading